카페검색 본문
카페글 본문
-
The history of the Sagrada Familia 2025.03.09해당카페글 미리보기
at 172.5 metre high and is seated over the crossing. The four Evangelist cimborios reach 135 metres and rise up flanking the largest cimborio, as well as the Virgin Mary one, which rises 130 metres over the apse. Finally, the twelve bell...
-
Re: 소장박테리아 과증식 nature 2025.01.13해당카페글 미리보기
a MoBio fecal DNA extraction kit, followed by 16 S rRNA amplification using Nextera library compatible primers flanking the V4 hypervariable region ([forward overhang] + 515 F: [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]GTGCCAGCMGCCGCGGTAA; and...
-
ATP biosensor reveals microbial energetic dynamics and facilitates bioprodu 2024.12.13해당카페글 미리보기
tetracycline (Tet25) and Gen35. Transformants were screened for the desired knockout using colony PCR with primers flanking phaJ4. Positive hits were re-streaked and screened again with a secondary colony PCR for the presence of wild...
-
North and South Korean athletes share an Olympic podium — and take a selfi 2024.08.02해당카페글 미리보기
silver medalists Kim Kum-yong and Ri Jong-sik, center, with Chinese gold medalists Wang Chuqin and Sun Yingsha flanking South Korean Shin Yu-bin. Lim Jong-hoon of South Korea takes a selfie with North Korean silver medalists Kim Kum-yong...
-
flank옆구리를 지키다 link (n.))와 관련 2024.06.27해당카페글 미리보기
사용되었습니다. 형용사로는 "옆구리나 측면과 관련된" 의미로 1660년대에 사용되었습니다. 관련된 단어로는 'Flanked'와 'flanking'가 있습니다. flank (v.) 1590년대 (군사) "옆구리를 지키다" 또는 "옆구리를 위협하며 측면에서 발사하다"는 flank...
-
용어집 - NCBI 핸드북 2024.05.23해당카페글 미리보기
genes. It provides more stable gene-specific genomic sequence for each gene including upstream and downstream flanking regions, and versioning information for conversion of coordinates in case of updates. refSNP In dbSNP, variant...
-
이럴 땐 par terre(파테어, 일명 빠떼루 : 바닥에서) 줘얍니다 2024.05.15해당카페글 미리보기
not applaud. To either side, walls with busts on herm pedestals backed by young trees screen the parterre from the flanking garden spaces. His landscapes displayed formal elements such as parterres, avenues, geometrically shaped lakes...
-
완벽한 중세 시대 성을 짓는 방법 2024.04.03해당카페글 미리보기
뽑힌다. 이제 커튼월을 강화할 차례다. 기존의 나무로 된 입구를 돌탑으로 강화하며 성벽의 각진 꼭지점마다 측면탑(Flanking Tower)를 세운다. 이런 측면탑을 세우는 이유는 위 짤과 같이 사격 반경이 벽에서 쏘는것 보다 더 넓으며 다른 탑과 연계하여...
-
comes info play와 flanking 2006.10.09해당카페글 미리보기
그러니까 예를 들자면 토큰이 하나 들어와도 Cloudstone Curio의 능력이 발동 되는건가요? 그리고 flanking능력말인데요. 친구가 말이죠 flanking능력을 가진 크리쳐가 공격을 하는 데 1/1 크리쳐가 방어를 했다면. flanking능력으로 1/1짜리는 -1/-1...
-
L’étranger 읽기 12 (13-15 p.) 2024.02.06해당카페글 미리보기
a slight limp. Little by little, the hearse was picking up speed and the old man was losing ground. One of the men flanking the hearse had also dropped back and was now even with me. I was surprised at how fast the sun was climbing in...